top of page

“…When we make comparison it is very important to us population geneticists that we can believe in the variation we see….”


While Chen spoke, giving a survey of his work at their general lab meeting, Gabe stared out the window of the conference room: below, the trim life-science campus lay peaceful as a winter golf course. What had been an old Italian neighborhood and water market had been retrofitted with the glass and steel aesthetics of surgical equipment. The city had helped the gentrification along, as did the Olivetti Botanical Gardens, which was nearby, the city, university, hospital, and gardens pulling together to create a massive neighborhood rehab project—new patterns of student and Topper life and a neighborhood of iFlex stores and cafés with sidewalk umbrellas emerging out of revamped facilities whose subsidized rent allowed them to serve as groundbreakers for other piecemeal green lots and tech buildings. Their building also housed a soy-based, food-additive design company, and a startup whose 3D printers could be used to output anything from pizzas to pistols.


A robin landed in the small ornamental tree just below. A robin in February. “We also have information,” Chen was saying…


“…that there are 30 proteins secreted in Phthiraptera Amblycera Menoponidae salivary gland,” Chen said, describing the comparison he was making between different louse populations. “Ten have been deposited in Gene Bank…” He checked his notes. “Accession No. AF335485.” Someone yawned. When he looked up, he saw Gabe, Meadow, Jak, Olympia, and a half dozen of her grad students, the main audience for these monthly meetings, looking back.


Olympia cut in, interrupting from the back of the conference room: “He means that when U of I looked at this they didn’t do accurate sequencing; they were just trying to get it out before another lab beat them to publication.” Instead of letting him continue, she explained to the other members of her lab group, lounging around the conference room, how the U of I lab was only interested in a single salivary-gland protein, SP-15.

​

Jak struggled with the tab on a thimble of coffee creamer. Gabe seemed to be considering a spot on her arm where she could get another tattoo; Silpa, wearing a lab coat over her sari, was paying attention, as were the grad students, scattered around the room in their jeans and tennis shoes. Shirley was even taking notes. Meadow, dressed like them in jeans and flannel shirt, sat on a window ledge, her feet in hiking boots dangling as though she were sitting on Lookout Ledge in some national park, and Olympia noted the difference between the group she’d assembled and those eager Uppies who filled offices in commercials for cloud computing, or other ‘business solutions’….


“So even though they established the library for salivary glands,” Olympia explained for the students, but also to get her crew’s attention, “they only sequenced them until they got up to the one they were interested in, SP-15. Then they just stopped there. The data wasn’t very good, but since it was the first, it’s the reference sequence that everyone else has built on.”


“Where did their lice come from?” Silpa asked.


“Probably the Congo,” Olympia answered.


“That’s a colony that we have to rebuild, right Gabe?”


The Congo, where Guy was stationed.


“…right Gabe?”


The mention of her name pulled Gabe back from the robin outside. She gave a nod. Slowly. Olympia knew damn good and well that the Congo lice were dead, but she never missed a chance to rub in the fact that the colony had been healthy just before it crashed and Gabe hadn’t been able to explain what went wrong.


A satellite view of Earth lit up the screen, Chen moving on to his next slide. Map pins marked the origins of the lice they were now working with: AMC— Amblycera Menoponidae from Paraguay; AMSB from southern Bolivia; and AMVN from Vietnam, near the Chinese border. All the places that had conflict minerals—and U.S. ground troops to protect them, Gabe noted.


As Africa rotated into view, Silpa wished she could zoom down to street level so she could see Guy—the real Guy, not the avatar Guy who tried to meet her every other Tuesday in W.2. Was he well? Was he safe? Until their next meeting, there would be no way to know, not with the military blackout.

​

She checked her watch. 10 a.m. Or ten hundred hours as he’d say it in his adopted language. The hottest, and so safest, part of the day still ahead. Then the sun would set and the fighting pick up.


“So, this question must be resolved….”


Someone else yawned.


Chen hated speaking at these meetings—called on to give a cartoon of what the math showed. “Everyone here can make the same excuse,” Olympia had insisted when he tried to get out of taking his turn at the podium. “Don’t they have show-and-tell in China?” She smiled that American smile of hers.


So instead of doing something useful, he wasted every fourth Monday in this conference room, “building teamwork” as Olympia called the turns they took explaining their part of the project: Gabe describing the difficulties of keeping genetic drift out of a lice-breeding program—when all he needed was her data; the meeting before that it had been Mohammed’s explanation about harvesting glands, Mohammed’s English also broken—only broken in a different way than his—and for that reason triply difficult. Next month he would waste time listening to the gewlo, Jak, then Silpa, then it would be his turn again…. At least the students listened.


He advanced his PowerPoint presentation to the next slide: a second string of AGCTs that made up SP-12, the twelfth protein in the genetic sequence of the louse’s saliva. “Same louse, same test, same target protein,” he said. The two strings of genetic code should have been identical but when he pressed the space bar, an underscore highlighted a number of letters in the two strings that didn’t match:

 

AGCCTTTACCTTAGGTCCCAAAGCCT….

AGCCTTT_ CCTTAGGT __ CAAAGCCT….

​

“My problem is ‘How can I believe in the information generated by these two sequences?’ We know mismatch equals mistake. But how do we know which string of letters is the accurate one? Which is the mistake? How do we know they are not both wrong?”


“Why is there so much noise in the data?” Olympia called from the back of the room again, irritated.


“We know noise equals mistake. We have no information about mistake itself. The mistake could be in sample,” Chen said, letting the finger of guilt point first to Gabe and the quality of the lice she bred. A number of the students glanced over at her. Then he let it point to Mohammed who somehow might have contaminated the glands he removed from the lice: “Maybe the solution he used to euthanize lice degraded its RNA. It could be faulty DNA caused by a bad primer or a bad sequencing reaction in the gel,” he said, allowing heads to turn to Jak for being sloppy in his sequencing.


“Maybe the mistake is in the math,” Jak said defensively, though everyone realized how lame that was, especially coming from him.


Chen took it in stride, listing the myriad ways the equipment and margins for error in the software could also contribute. “We can never have certainty,” he said. “Only degrees of probability.” Around the room, he could see everyone but Olympia relax.


Chen pointed back at the string of AGCTs, explaining that to correct inconsistencies they would have to go back to the raw data generated by the sequencer.


“But the raw electropherogram is just a bunch of bars produced by the chemical reactions inside the sequencer,” Jak said, still on defense, making his appeal to Olympia. “A person can’t see it any more than they can watch the electrons shoot around the chips inside their computer.”


Instead of arguing, Chen agreed, adding, “So we either go on faith or we do a statistical analysis to assess its reliability. This is called the PHRED.” Next slide: “The PHRED is a number of reliability; it counts all the mismatches in every run and allows you to set a threshold above which you will accept the sample. Here I set the PHREDPHRED at 10, which means I will accept 1 mistake for each 1000 bases analyzed. In order to have more confidence we can use a PHRED of 30. This allows us to distinguish between a nice region and a bad region. The bad portion is eliminated from further consideration. We then only work with sequences that have a low incidence of error. Good sequences.”


He projected another graph, plunging into the math. Jak gazed at equations as though watching a light show. Silpa looked moonily at the empty seat beside her, while Gabe drifted back to looking out the window.


Christ, it was hard to pay attention to Chen’s lectures, Gabe thought, doodling a bird. It wasn’t so long ago that she’d been a student herself and, like the students in the room, eager. Sally?—that one with creative hair who was writing a dis on protein folding and using a gel pen to take notes?—that would have been her, excited to learn how once nature was conceived as accounting anything was possible.

 

Gabe counted the robins outside: seven or eight more. Cold and shivering.


She’d never seen robins cluster for warmth. They were doing such a piss-poor job of it that they looked more like strangers waiting for a bus than the tight pack that penguins formed…. In grade school, she and the other kids used to compete to spot the first robin of spring—it meant that the Chicago winter they’d endured was over, the earth softening, sap as well, trees and flowers on the verge of exploding into bloom with summer vacation as close as their shadows. Now the sight of the first robins filled her with dread. Dead man walking. Faux springs would always snap unexpectedly: the trees that had begun to bud would harden back into their dormant state, the erratic weather having the double whammy of leaving fewer robins to return when spring—the real spring—did arrive.


Further north, she knew, in the Arctic, birds that normally stayed in the lower 48 states would be mingling with birds that normally stayed in Asia, the lakes of melting tundra that were now forming allowing them to come together as they never had before. The slimy cesspools of bird shit, and rotting feathers that choked Asian farms were breeding grounds for all kinds of pathogens. The cows, pigs, and other mammals that tramped through it, and sneezed, and licked each other on those farms were incubators for viruses that could jump to humans. They passed them on to migratory birds, but even migratory birds didn’t cross oceans. Until now. With the warming north, the routes of migrating birds were stretching into Siberia and Beringia; their breeding seasons were becoming longer and longer, and already North American birds, like gyrfalcons and northern pintail ducks, were carrying Asian cholera and flu back down into Oregon where with no natural barriers, they could spread as wildly as a California fire throughout the rest of the country. The last ‘minor’ outbreak had been stopped by slaughtering 70 million domestic birds; the heaps of bodies from one farm alone formed a berm 3 miles long. Looking at the robins outside, she knew that unless someone came up with a prophylactic, it would only be a matter of time before those berms were made of human bodies.


Jak gazed at Chen’s colored graphs: sine waves as beautiful as rainbows. The Art of Science is the Art of the Future! It made him think of The Art of the Past: Once, back in college, he and his roommate were about to roll a blunt when they realized that they didn’t have any papers. “What about that old book,” his roommate said. “Bet it would burn real good.” Kindling-dry pages—a natural history book that Jak had checked out on a whim. God and Nature or something. “Guess nobody will miss just one,” he said, tearing out a page. On the reverse side was an engraving of a bird, which once the blunt was rolled, seemed to be reaching with its beak for the lit end. “It wants some!” Jak’s roommate said, handing the blunt over, “but he’s trying to toke the wrong end!” The joke got funnier and funnier as they passed the blunt back and forth, the glowing end getting closer and closer to the bird’s beak—“Watch out Tweetie Pie!”—until the bird’s beak was burning, caught in a forest fire of one…. “The science library ought to give us an award for discovering a use for those old books.”


Flocks of passenger pigeons used to be so large that they could take four hours to pass; but the last of them died in the Cincinnati Zoo in 1913.


Sine waves rippled across Chen’s body as he walked into the beam of the projector to point at something on-screen. “…this red curve shows….”


Scrawled on the dry-erase board behind him were equations left by whatever lab group had used the conference room before them—as food decreases, cannibalism increases.


Meetings like this made Meadow wonder if she should have stayed back in Oregon. When Olympia invited her to join her lab, the effort to close up the house, move to Chicago, seemed to require more energy than she could gather. But then, the more she thought about it, the more it seemed like a change of scenery might get her out of her perpetual funk. She hadn’t worked since Nico vanished, just went for long walks in the woods with her spaniel. Drifting, William called it. Drifting, the way she liked to imagine Nico out there in all that blue: playing pirate, fishing, enjoying himself until he was found…. “You can’t just drift the rest of your life,” William had said. Of course he was right, though she also knew it was better than sinking.


Better than studying home videos of the tsunami that people posted online—play, pause, play—over and over, longing for a glimpse of Nico in the background….


A new job seemed a reset in some ways. A fresh start if not a clean break—on a study that seemed to be calling to her: Back at Berkeley, they’d worked in different labs but each of them had just given birth to baby boys. As individual puffins seek out the same kind of sheltering rocks and so form a colony, both Olympia and Meadow would retreat into the storage room that the university had converted into a lounge for women. Twice a day, the cycle of lactation, they’d both be in there, using breast pumps, their individual needs causing a pattern to develop at the next higher order: There they got to talking, first about the babies, then the husbands who stayed at home to watch them, Olympia saying how hard it was to have an infant at home and do all the things she needed to do to oversee her lab. Their conversation came around to shop talk.


Olympia was PI in a lab studying the biology of mutations into pandemics. Meadow was working on an MA in disease vectors. To the rhythmic, mechanical suck of the cups they held to first one breast, then the other, they discussed how a cell mutates as it is passed from one animal to another, and the possibility of bird lice saliva providing some immunity against certain bird-born diseases.


The speculation had first been proposed by another woman researching bird lice in a forest that no longer existed, and the oddity of the world came to Meadow whenever she recalled how much of her own life—where she lived, how she lived—had its genesis in an insight that a woman she’d never met had had 40 years ago while on a wild-goose chase in Paraguay. Now here it was—just a footnote—still shaping her life. And Olympia’s life. And maybe, if everything went well, the lives of millions of others. Who could explain such things?


Olympia sat at the back of the room, her brow furrowed over all the things that could derail their study. Did her own life ever seem odd to her? Meadow wondered. Did she think about her husband and son out on the West Coast?


Funny, Meadow thought, looking at the reams of data Chen projected, how the smallest things can create such dramatic results. For lack of a nail the kingdom was lost…. Funny how the strangest things can become natural. Kissing while wearing face masks. Someone might live because of the work done here in this lab; someone else might die because of what they didn’t do, just as during the tsunami some ran to the mountains, others to the beach—a branch in the path at every step—and I?—I took the one less traveled by and that has made all the difference—if that long-gone entomologist hadn’t gone off on her wild louse chase in Paraguay, Meadow wouldn’t have studied what she did at Berkeley, wouldn’t have met her husband, wouldn’t have had her son when she did, wouldn’t have had the conversations that her and Olympia did, wouldn’t be here in Chicago, working on what they were working on….

 

Looking around at the grad students and her group, Olympia wondered what it would take to keep them in the dark as she shifted the direction of their research. Not much, she figured, since she was the only one who had an overview of how the pieces went together. And the only part that would really change would be the direction of the last phase. Even if they did notice changes in protocol, they knew that a line of inquiry could sometimes go off in an unexpected direction, or raise interesting side questions. They understood that a PI sometimes had to say one thing to stakeholders or administrators in order to do what was best, like the half-truth she’d told Meadow to get her to move here: that their research could lead to a vaccine that could benefit the Bottom Billion. Or the white lies she told to get funding. When she proposed the study, all she was really interested in was the science; then, after the government got rid of the EPA and downsized its involvement in science, she had to pretend she was concerned about soldiers, her grant proposals pitching her research as knowledge that could potentially lead to a vaccine against diseases carried by bird lice where U.S. troops were stationed. Her local congressman had made an impassioned speech on the House floor—It’s our patriotic duty to protect our sons and daughters fighting to keep us free!—and in the end, her funding had been attached to a bill that also included pork-barrel spending to pay a local cement contractor to make barricades, and a corporate-gift supplier to send cheese baskets at Christmas.


The team Olympia assembled had been cranking on the study ever since: Gabriella—Gabe—was in charge of breeding the 100,000 lice needed for the study from the initial colonies and birds that the army supplied, capturing them in the three different conflict-mineral zones where troops were operating. It was Mohammed’s job to remove the saliva glands from these lice—200,000 glands. Jak ran the automated equipment that sequenced the genes found in the saliva of these glands. Using these databases, Chen was identifying the strings of genetic letters that made up the 20–30 proteins that the U of I lab estimated were in the saliva of one species of blood-sucking bird lice. For the moment, she had Meadow helping to create a library of the genetic fingerprints. As that part of the study rolled along and the genetic ID of the proteins became known, Silpa and Guy began exposing each of the identified proteins to some 1,000 human blood samples; they would note which protein caused which blood type to generate the most white blood cells—an upsurge of white blood cells being a firmly established indicator of an immune response.


If all went well, spikes in the data would rise like a new mountain range to show which of the proteins triggered the most vigorous immune response in the majority of human blood types AND was found in all three of the lice populations, that is, throughout all conflict-mineral zones.

​

Just about the time it began to do so, those venture capitalists came sniffing around, asking if she had any idea how much more money she could make as the PI in her own corporate lab….


The best way to help yourself is to help others, Meadow’s mother always said, so to get her mind off of Nico, she’d volunteered her expertise to the Noah’s Ark Project: zoos around the world that coordinated their efforts to serve as a global lifeboat for species losing their habitats. The article she’d read about the project had sounded so upbeat: the zoos would coordinate to build an environmental zone from pole to pole so animals all over the world could retreat into it as the Earth ‘flooded’; then, if the environment ever became habitable for them again, they could repopulate the Earth. A pole-to-pole zoo. But, of course, that had all just been a beautiful dream, fit for a world that didn’t have conflict minerals and civil wars and poachers…. That didn’t account for the fact that polar bears would start eating 1,500 goose eggs an hour when they could no longer get seals…. Still, even scaled back—zoos as lifeboats—the basic idea was how earlier conservationists had brought back the American bison. But with the Earth warming, the wild was disappearing faster than its ice. The Cleveland Zoo had saved the Kihansi spray toad when Tanzania built a hydroelectric dam, but their habitat—the spray off the waterfall they lived near—had been wiped off the Earth, and the Kihansi spray toad was stuck forever in the Cleveland Zoo, living within the spray coming from stainless steel nozzles. Frantically, zoos and others began geotagging wolves and elephants and elk, trying to determine which had the best chance to be saved—soon, the squirrels in her yard were more wild than the sharks in the sea—still, the extinctions mounted, hundreds, then thousands, so many species going extinct that even the tiny proportion singled out for saving began to swamp the lifeboats, and the zoos were forced to choose: which animal to house, which had to be put on birth control (grizzly bears, giraffes and hippos), and—the part she hated most—which animals had to be euthanized.


Zoos killing leopard cubs…. “To maximize genetic diversity in what minimal space we can offer.” She’d been put on a committee that determined which animals to kick out of the lifeboat. The plate-billed mountain toucan?—only able to live at an altitude of 1,000 to 2,000 meters on the western slopes of the Andes?—fugetaboutit. The lion-tailed macaque? Toast. The gallows humor others used to cope had started to get to her. Sophie’s Choice. Every day. Pick one: The mhorr gazelle or the addra gazelle? Her mind would fill with images of the Titanic without enough lifeboats to save the men. Then not enough to save the women. Then the children—and more and more of her time was taken up picking out the weakest—those that weren’t interesting enough to gain a celebrity champion or millionaire philanthropist—to throw overboard, to make room for new arrivals that might have a better chance of getting a Twitter following. Most people thought zoos were about animals, but she knew: the ways zoos treated their animals always said more about humans. What was surprising was how completely nature had become accounting.


Some days she resigned herself to being an accountant, working to make a bad situation as good as it could be. Other days it just seemed overwhelming, pointless; deckchairs, not lifeboats on the Titanic: animals at the equator pushing into lateral zones, those in lateral zones pushing into northern climates with the big animals, those that needed big ranges, being the first dominos pushed off the planet, Noah’s Ark having reached what turned out to be, after all, the edge of a flat Earth.
Even the zoos themselves began to give up once harmless bacteria began to flip into pathogens that could kill off an entire species at once: the Sumatran rhino, the blackfooted ferret, the African wild dog…. Bulldozers had been needed to dig mass graves for the last 50,000 saiga antelopes, grazing in a safe zone on the steppes of Central Asia when the entire population suddenly collapsed, like a colony of fruit flies…. The zoo that had put so much effort into creating that safe zone shifted its efforts into luring visitors with new exotics: a Galápagos tortoise cloned from Lonesome George, a tortoise that had not only been the last of its species but had even been studied by Darwin—zero degrees of separation—a mastodon that had been coaxed out of the DNA recovered in Siberia and implanted in an elephant womb; chickens that had been reverse engineered to resemble dinosaurs; or less glamorously, the coy wolves, brown polar bears and the other animals that had began to mate with each other and take on the mutt-like, muddied characteristics of the village dog.


Meadow hadn’t needed long to give Olympia an answer. Working on Olympia’s project would help, in its small way, put the world back in balance. At least her world. And if a vaccine actually came out of it, then Nico’s beginning, if not his end, would have some meaning. At least that’s what she told herself, believing that because Olympia’s son was the same age that Nico would have been had he lived, Olympia would understand…. Then Olympia pulled that article they’d had accepted for publication.


Because of the data? she wondered, looking at Olympia watch Chen now, her features focused as a rifle. Meadow had forgotten, or didn’t let herself remember, that Olympia’s son and husband stayed in California. That she flew out to visit them every other week, then once a month, and now, even less than that. Meadow had forgotten that while she’d pumped herself dry so Nico could have breast milk during the days she couldn’t be home to give it to him, Olympia did so to relieve the ache; while Meadow emptied the pump into a bottle she had sterilized so she could take her milk home to the baby, Olympia always dumped hers down the sink.


“Keep your hatchet scoured,” Olympia learned from the military guy assigned as her liaison: “the first rule of army preparedness.” But even better would be to say: A hatchet is a thing; a psycho is a thing; a psycho with a hatchet is a third thing, one that makes other possibilities possible. And that’s all she was doing, talking to those venture capitalists: looking into other possibilities. From their point of view her study was ideal: too academic to be initiated by Big Pharma, but with the potential to be bought out once she demonstrated its feasibility. So okay, maybe to recruit Meadow she did exaggerate the possibility of their research benefiting the Bottom Billion. Maybe she even talked herself into believing that she only got into bed with the military for their seed money. But every biologist on Earth knew what a long shot it was for a practical vaccine to come out of academic research and only a fool could believe that if one came out of theirs, it would be used anywhere but on an American GI.


“…many question marks, little information….”


Winter didn’t arrive this year, everyone in the lab said, but Silpa could never get warm, the damp Midwestern winters so radically different from the tropical heat of home that it seemed to permeate her bones. Guy used to tease her about always being cold, wearing a sweater against summer air-conditioning, and she imagined him now, out in the heat of Paraguay never able to get cool.


She used to tease him about joining the army.


Army Reserve, he always corrected—before his unit was called up and he actually had to go. The first time, she had not meant to be funny. She had spoken harshly—a jab—though not so much at him as at his country where war was a way of life. But he had turned it into a joke between them, putting on a cowboy drawl as he put blood samples in the centrifuge, “Terrorist talk like that gets people deported, ma’am.” He took her aspirator, blew on its end as if it were a pistol that he holstered in the pocket of his lab coat. “A nurse who carries a gun,” she had scoffed. “What kind of nurse is that?” “One with student loans, ma’am.” And he had sashayed away, whistling a plaintive song from a western.


But all that teasing was back when the war was as abstract as a movie. Before the day he nonchalantly told her that his unit had been called up. She sat at their lab bench stunned, the words incomprehensible, until he jotted an address on her lab pad: guy78@usarmy.gov, the black pen strokes somehow making his going real, the address concrete, material evidence, a link in cyber-space, she knew, to a location in actual space where the shooting, blood and death would be real. “In case anyone wants to write me,” he’d said.


“…a reliable sequence, something I can believe in.”


The floor vibrated. Then it did it again, followed by a dull, heavy pounding from the construction that was going on downstairs, the Insectarium on the second floor being converted into a Biohazard Containment Level 3 room.


On the wall, next to the regular clock, was a Doomsday Clock: a bar of red digits counting down how many days, hours, minutes, seconds they had until the avian flu virus jumped to mammals. The clock was a matter of speculation, of course, based on probability and mutation rates. A pharmaceutical lobbyist had a dozen of them made for congressmen to take to the floor when they argued for funding. Made a great visual. But listening to Chen, the clock seemed to stand still, and Jak snickered how they should use his lectures as a prophylactic against avian flu, cancer, aging, vacations ending….

​

“I cannot assume that the sequence for PP louse saliva protein SP-12 taken from flies in North Bolivia is the same as the sequence for saliva protein SP-12 taken from flies in South Bolivia. Here we have no previous informations….”


Christ, another sub-study. Jak could see it coming, Olympia’s eyes narrowing like a boxer in close enough to take punches. Her scowl turned his way and he looked back at the screen.

World Clock2.png

People were the weak link of any study, Olympia knew, looking around at the characters that had coalesced around her project. That’s what worried her now. The students were all engaged, but Mohammed’s mind seemed a million miles away, on the status of his green card or whatever else was bugging him. Gabe was still staring out the window; she could be a problem, Olympia thought, looking at her tattoos. C12H22O11 ran across the base of her neck: sugar. But she was anything but sweet, mixed up with NGers—Neon Greeners, or punks or whatever they called themselves. Too late, Olympia had learned that Gabe had been a whistleblower in a previous lab. She could be a problem. Unlike Silpa, lab coat over her sari, keeping company with the empty seat that Guy used to fill at these meetings. The only one looking at the screen was Jak: vacant grin fixed on his face as though he was dreaming of the perfect wave. Was he on something?


She’d brought Mohammed in on a Tech Visa because the dissections he did in her lab were very similar to the dissections he did for the CDC in Venezuela, so he’d be okay if he could keep from thinking immigration was out to ruin his life. Jak was the one slacker, an inheritance from the previous lab director, she suspected, because his San Diego surfer attitude made him too lazy to look for another job after the shakeup. But the ABI that he ran was so automated that even an undergrad could handle it. Silpa was a phlebotomist and had been a very good Pathology Assistant back in India. She’d worked well with Guy, their all-American jock, until the army shipped him out. She took it so hard that Olympia figured the two of them were sleeping together. Even so, even without Guy, she was able to keep up with the pace of samples that arrived weekly: blood drawn from soldiers who’d never been exposed to lice in the conflict zones; blood from local villagers who’d grown up being bitten by blood-sucking lice of their area; and random samples from the blood bank in Indianapolis that they used as a check. From the attention Silpa gave those samples, you’d think the blood had come from Guy, which, come to think of it, was a possibility.


Chen’s statistical analysis was rock solid, good science because he understood both the math and the biology, his humorless rigor making it easy to see why China had begun to eat everyone’s lunch in a number of research areas ever since the U.S. made an ignoramus president.


Then there was Meadow, sad-sack Meadow, the only one she actually recruited—for what she knew about bird lice. True enough she’d lost a child, but even before that she’d been all touchy-feely. Didn’t she live in a teepee for a while?

​

​

The last time Guy had been able to make their rendezvous in W.2, Silpa had dressed in a dove-white sari, bloodred ruby in her bellybutton such as she would never wear during a Chicago winter. He had dressed his avatar in cut-off jeans and a Hawaiian shirt, since they’d agreed to meet on a beach. In Waikiki.2: a deserted stretch they had found away from the Kittychans and dance parties, the New Agers building that pyramid…. Far from the fighting in the Congo or Paraguay or Bolivia or any of the other conflict zones. A soldier on leave could go anywhere. So long as he did it virtually. There, their toes in sand made of pixels, he described the training he got before shipping out: four days on a shooting range scattered with store-bought tumbleweeds to simulate someone’s idea of Africa. Then there was the real action: suturing up the leg of a ten-year-old boy who had been playing with a grenade—or had he tried to throw it at them during a firefight the night before? The patrol that Guy had been on had been ambushed by people who looked like the family watching him sew up their son. He described going door-to-door on patrols during the day to provide medical care—mission objective: win the hearts and minds of the civilian population—then going out on patrols at night to bust down those same doors to round up sons, fathers, brothers, or some other individual that an informer had fingered as a ‘person of interest’. Sometimes, he found himself waking up in the shell of an apartment they had bivouacked in not sure if it was night or day. Sometimes it took him a few minutes to remember if the other GIs waking up around him were readying their weapons to escort him on his humanitarian rounds or if this was a shift where he escorted them on their suspect roundups….


Lying side by side on the beach, a sky the color of a blue screen saver, she’d slipped her avatar’s fingers into his, and via the VR glove she wore she could feel him squeeze her hand back. She tried to comfort him with the myth of Arjuna, the warrior-king filled with doubt on the eve of a battle. At his moment of self- recrimination, his chariot driver revealed himself to be Krishna, the multi-faced God.


Guy had remained silent, listening to Silpa tell how Krishna reminded Arjuna of Dharma, the duty to remain faithful to yourself, and by so doing remain faithful to the cosmic order.


When she finished, he answered with a story of his own about doing his ER training at the University Med Center before the area had been gentrified. Back then, the teaching hospital and a few high-end condos formed an archipelago in a sea of beat-down housing. “Same planet, different worlds.” And no poet ever dreamed of the cosmic order that they formed together.
After being mugged for the second time, one of the night-shift doctors had begun to carry a gun. Then one night, as he was putting his briefcase in the trunk of his car, someone put a knife to his back and demanded his wallet. Instead of giving it to him, he calmly turned, hand in his Tommy Hilfiger coat pocket, and shot right through it into the mugger’s stomach. A teenager. The single shot cut his lineal, and he began vomiting blood. “I was on duty when they came in,” Guy said. “The doctor had managed to get the kid back to the emergency room he had just left where they saved the boy’s life.”


“And the moral is?”


“‘Sinner, saint, pauper, king—there but for the grace of God go I,’ mother would say, which I always took to mean,” he said, releasing her hand to fold his arms over his head in the posture they made prisoners take, “here but for the luck of the draw squats anyone.”
Now, here in the conference room beside her, the chair Guy always sat in at these meetings was empty. If he knew how she felt looking at it, she thought, he’d know how wrong he’d been.


“…we have much information….”


Mohammed snuck looks at the faces of the others in the room, trying to read them. Had Silpa turned him in? Because he was from the country Guy had been sent to fight? Before their government sent him off to die, he and Silpa used to always sit together at these meetings, because, Mohammed initially thought, it was natural, she and Guy forming the lab unit that processed blood. But had there been more between them than that? Sex? Politics? Once, passing by the hooded area where they processed blood, he heard him tell her, ‘Terrorist talk like that gets people deported, ma’am.’ A moment later—after they had seen him—Guy had walked away as casually as the cat who ate the canary, whistling a theme song from a cowboy show. Had they been talking about me? Mohammed had wondered. When they saw him they abruptly switched subjects, Silpa looking down, smiling at whatever private joke had passed between them. Is that why she kept averting her eyes now? he wondered. Guilt? Over what?


Dense statistics, alien languages from The Planet Calculus…. Errors were cumulative. Complex reactions, tiny margins for error adding up to dead certainty. No better than a placebo. Or worse. After spending millions of dollars testing the blood thinner Heparin, allergic reactions never seen in the lab triggered fatal drops in blood pressure out in the wild….


Uh-oh, uh-oh, uh-oh, Olympia thought waiting for Chen to drop the other foot. And here it came: some screwup, or faulty assumption, showing up in the data the way all those DNA tests—thirteen months and $180,000 worth of grant money—that showed early dinosaurs were birds had to be thrown out after the researchers begin getting crazy results: dinosaur DNA carrying the DNA of fish, the fish DNA later shown to have come from a tech, like Jak, who’d had tuna for lunch and then didn’t wash his hands….


Olympia could feel her bowls clench.


Her logic had been tight: find a single protein in all species of lice that would trigger an immune response in all types of human blood; use it to develop a single vaccine—one that could be administered to all soldiers regardless of which parasite they were exposed to.
Crap, she muttered, when she saw the next slide, a picture of the worst-case scenario coming true: that the lice from each conflict zone were genetically different, even if they were the same species.


“Even if I only use samples with high reliability,” Chen said, pointing out a string of AGCTs, “we still find this stretch of DNA that codes for G, a glycerin, whereas in the same protein, SP-1B from Bolivia, we find the code for aspartic acid….” He continued down the list, pointing out the differences in each of the proteins they had sequenced in the saliva in each of the louse populations, SP-1V, SP-1B, SP-1C; SP-2V, SP-2B, SP-2C; SP-3V, SP-3B….


As Chen spoke, Olympia could hear her statistical ground turn to sand.


“Why is there so much variability between populations?” she snapped.

​

Angry. Murder the messenger.


And Chen’s not even taking into account genetic drift in the lab, Gabe thought. According to the records she kept, the flies she now had in the Insectarium were 150 generations from the original breeding pairs. If they were humans, they’d be the equivalent of modern descendants of Neanderthals, the life span of the fly so short, and their breeding so fast, that they could rack up generations of Biblical proportions before she reached the end of a logbook. It always raised the question of how much they had mutated according to the conditions of the lab. I’ve got some good news and some bad news, she could imagine Olympia announcing. The good news is that our vaccine works. The bad news is that it only works on birds in our lab.


Olympia and Chen often got into it in ways that were fun to watch, Jak thought, shifting his chair to give him a better view.


“This is curious thing: we have a protein, but we find variation in the protein here, here, and here,” he said, pointing at the strings of genetic letters. What does it mean to have variability in the peptide region? Answer: variability in protein depends on the response of the host.” He explained how the genes in the saliva could respond to the environment. “If you change the host, you change the blood source that the louse feeds on, and the proteins in the saliva of the louse can change in response. This is why proteins in the saliva from sand flies taken from rodents in the field are different from those in the saliva of the same species taken from urban areas where their blood supply also contains humans. The flies that jump to humans produce more saliva because they need more saliva to anesthetize the skin of a human than a rodent. Those that did survive long enough to jump back onto a living rodent might also be those most adapted to anesthetize human skin. Over the generations, the DNA sequence of the protein that does the anesthetizing will change. It will have a better chance of survival, and therefore pass on this trait to its host, the species it normally lives on.”


“But this doesn’t necessarily mean it will cloud our study, right? I mean, the protein that anesthetizes skin will be a different protein than the one that triggers an immune response. And for all we know,” she said hopefully, “the protein that gives immunity could be conserved across all these different populations. Right?”


“But here is the curious thing: human blood can also change in response to the parasite. This is why we are beginning to see that human blood taken from

​

Paraguayan natives exhibits an immune response to SP-1, while blood from natives in west Bolivia exhibits an immune response…” He checked his notes.
“…to SP-22.”


“So are the lice proteins changing in response to the different host blood, or is the blood of the host changing in response to the lice?” Olympia asked, knowing how this last variable could throw the whole study into a spin, the way adding a third body to a gravitational equation makes a relatively straightforward problem hopelessly complicated.


“Big question mark. On this point we must remain silent. At least until we have more data.”


“Well that’s just great!”

bottom of page